IthaID: 2990


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 55-59 (-13 bp) HGVS Name: HBB:c.167_179del
Hb Name: N/A Protein Info: β 55 - 59 (-ATGGGCAACCCTA); modified C-terminal sequence

Context nucleotide sequence:
TTTGGGGATCTGTCCACTCCTGATGCTGTTA [-/TGGGCAACCCTAA] GGTGAAGGCTCATGGCAAGAAAGT (Strand: -)

Also known as:

Comments: Published as HBB:c.166_178delATGGGCAACCCTA, which does not follow the HGVS Sequence Variant Nomeclature guidelines.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70891
Size: 13 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Created on 2016-08-23 17:40:56, Last reviewed on 2019-11-11 11:58:36 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.