IthaID: 2988


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: -54 G>A HGVS Name: HBA2:c.-91G>A
Hb Name: N/A Protein Info: α2 nt -54 G>A

Context nucleotide sequence:
CGCGCCAGCCAATGAGCGCCGCCCG [G>A] CCGGGCGTGCCCCCGCGCCCCAAGC (Strand: +)

Also known as:

Comments: Found as a heterozygote with mild microcytosis. Point-mutation located at the proximal promoter region between two regulatory motifs recognised by the transcription factors Sp1 (Specificity Protein 1) and α-IRP (α-inverted repeat protein). Functional studies showed that it can cause up to 36% reduction in the transcriptional activity.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33685
Size: 1 bp
Located at: α2
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Qadah T, Finlayson J, Dennis M, Ghassemifar R, Molecular and cellular analysis of three novel alpha2-globin gene promoter mutations [HBA2: c.-59C>T], [HBA2: c.-81C>A] and [HBA2: c.-91G>A] reveal varying patterns of transcriptional and translational activities., Pathology , 46(1), 46-52, 2014
Created on 2016-08-23 17:11:10, Last reviewed on 2017-07-31 12:12:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.