IthaID: 2971
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | -44 C>A | HGVS Name: | HBA2:c.-81C>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AATGAGCGCCGCCCGGCCGGGCGTG [C>A] CCCCGCGCCCCAAGCATAAAC (Strand: +)
Comments: Found as a heterozygote. Point-mutation located at the proximal promoter region affecting the α-inverted repeat protein (α-IRP) recognition site. α-IRP is a transcriptional activator. Functional studies did not show a statistically significant change in the transcriptional activity compared to the wild type. Reported as a polymoprhic variant.
Phenotype
| Allele Phenotype: | Neutral |
|---|---|
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 33695 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Qadah T, Finlayson J, Dennis M, Ghassemifar R, Molecular and cellular analysis of three novel alpha2-globin gene promoter mutations [HBA2: c.-59C>T], [HBA2: c.-81C>A] and [HBA2: c.-91G>A] reveal varying patterns of transcriptional and translational activities., Pathology , 46(1), 46-52, 2014
Created on 2016-08-23 15:41:43,
Last reviewed on 2017-07-31 12:18:46 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.