IthaID: 2958


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 7/8 (+G) HGVS Name: HBB:c.24dupG
Hb Name: N/A Protein Info: β 8(+G); modified C-terminal sequence: (8)Glu-Val-Cys-Arg-Tyr-Cys-Pro-Val-Gly-Gln-Gly-Glu-Arg-Gly-(22)COOH

Context nucleotide sequence:
GGTGCATCTGACTCCTGAGGAG [-/G] AAGTCTGCCGTTACTGCCCTGT (Strand: -)

Also known as:

Comments: The mutation causes a shift of the open globin reading frame, which leads to the development of a terminal codon in codon 22. The thalassaemic allele is associated with the mediterranean haplotype IX. The mutation presents with beta0-thalassaemia minor and slightly elevated HbF.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70618
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Slovakian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Kynclová E, Divoký V, Kovaríková L, Melichárková R, Indráková J, Divoká M, Hammerová T, Sakalová A, Hudecek J, Indrák K, [New beta0-thalassaemic insertion mutation (CD 7/8, +G) in a Slovak family, associated with the Mediterranean haplotype IX]., Vnitr Lek , 45(3), 151-4, 1999
  2. Divoka M, Partschova M, Kucerova J, Mojzikova R, Cermak J, Pospisilova D, Fabryova V, Prochazkova D, Indrak K, Divoky V, Molecular Characterization of β-Thalassemia in the Czech and Slovak Populations: Mediterranean, Asian and Unique Mutations., Hemoglobin , 40(3), 156-62, 2016
Created on 2016-08-23 11:50:36, Last reviewed on 2019-11-12 16:20:42 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.