IthaID: 2955


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 49-57 (-24bp): (-GCCACGGCTCTGCCCAGGTTAAGG) HGVS Name: HBA2:c.149_172del
Hb Name: Hb Goya Protein Info: α2 49(CE7) - 57(E6) Ser-His-Gly-Ser-Ala-Gln-Val-Lys-Gly->0 AND inserted Ser

Context nucleotide sequence:
ACCTACTTCCCGCACTTCGACCTGA [-/GCCACGGCTCTGCCCAGGTTAAGG] GCCACGGCAAGAAGGTGGCC (Strand: +)

Also known as:

Comments: Hb Goya is probably a low affinity Hb variant. The heme group is bound to a His residue (distal His (E7)) that is altered in this variant. Patient presented with low baseline oxygen saturation (87-92%) without cardiac or pulmonary pathology.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: Decreased Oxygen Affinity
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34041
Size: 24 bp
Located at: α2
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. de la Fuente-Gonzalo F, Nieto JM, Ricard P, Anguita J, Martínez R, Cervera A, Villegas A, González FA, Ropero P, Hb Cervantes, Hb Marañón, Hb La Mancha and Hb Goya: Description of 4 new haemoglobinopathies., Clin. Biochem. , 48(10), 662-7, 2015
Created on 2016-08-23 11:12:44, Last reviewed on 2016-09-09 11:58:37 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.