IthaID: 2955
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 49-57 (-24bp): (-GCCACGGCTCTGCCCAGGTTAAGG) | HGVS Name: | HBA2:c.149_172del |
| Hb Name: | Hb Goya | Protein Info: | α2 49(CE7) - 57(E6) Ser-His-Gly-Ser-Ala-Gln-Val-Lys-Gly->0 AND inserted Ser |
Context nucleotide sequence:
ACCTACTTCCCGCACTTCGACCTGA [-/GCCACGGCTCTGCCCAGGTTAAGG] GCCACGGCAAGAAGGTGGCC (Strand: +)
Also known as:
Comments: Hb Goya is probably a low affinity Hb variant. The heme group is bound to a His residue (distal His (E7)) that is altered in this variant. Patient presented with low baseline oxygen saturation (87-92%) without cardiac or pulmonary pathology.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-chain variant |
| Allele Phenotype: | N/A |
| Stability: | N/A |
| Oxygen Affinity: | Decreased Oxygen Affinity |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34041 |
| Size: | 24 bp |
| Located at: | α2 |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- de la Fuente-Gonzalo F, Nieto JM, Ricard P, Anguita J, Martínez R, Cervera A, Villegas A, González FA, Ropero P, Hb Cervantes, Hb Marañón, Hb La Mancha and Hb Goya: Description of 4 new haemoglobinopathies., Clin. Biochem. , 48(10), 662-7, 2015
Created on 2016-08-23 11:12:44,
Last reviewed on 2016-09-09 11:58:37 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.