IthaID: 2950


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs16912979 HGVS Name: NG_000007.3:g.9151A>G

Context nucleotide sequence:
CTGCGTCCCCTCTTGTGTACTGGGG [C/T] CCCCAAGAGCTCTCTAAAAGTGATG (Strand: +)

Also known as:

Comments: SNP is located in DNase I HS-4. It was reported to influence HbF expression levels in Saudi patients with sickle cell disease. SNP associated with disease severity and HbF levels in Thai β0-thalassaemia/HbE patients.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 9151
Size: 1 bp
Located at: βLCR
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Saudi, Thai
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Nuinoon M, Makarasara W, Mushiroda T, Setianingsih I, Wahidiyat PA, Sripichai O, Kumasaka N, Takahashi A, Svasti S, Munkongdee T, Mahasirimongkol S, Peerapittayamongkol C, Viprakasit V, Kamatani N, Winichagoon P, Kubo M, Nakamura Y, Fucharoen S, A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E., Hum. Genet. , 127(3), 303-14, 2010
  2. Vathipadiekal V, Alsultan A, Baltrusaitis K, Farrell JJ, Al-Rubaish AM, Al-Muhanna F, Naserullah Z, Suliman A, Patra PK, Milton JN, Farrer LA, Chui DH, Al-Ali AK, Sebastiani P, Steinberg MH, Homozygosity for a haplotype in the HBG2-OR51B4 region is exclusive to Arab-Indian haplotype sickle cell anemia., Am. J. Hematol. , 91(6), E308-11, 2016
Created on 2016-08-10 10:06:50, Last reviewed on 2016-09-28 12:57:46 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.