IthaID: 2948
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1799983 | HGVS Name: | NG_011992.1:g.12965T>G |
Context nucleotide sequence:
CCCTGCTGCTGCAGGCCCCAGATGA [G/T] CCCCCAGAACTCTTCCTTCTGCCCC (Strand: +)
Also known as: G894T
Comments: SNP associated with age onset of menarche in females with sickle cell disease from India (39 cases; 48 controls) [PMID: 23795274]. SNP (T allele) associated with higher hematocrit and haemoglobin levels in Greek patients with severe clinical course of SCD [PMID: 27871907]. SNP (GG genotype) associated with an increased reticulocyte count and high serum lactate dehydrogenase levels in pediatric SCA patients from Portugal [PMID: 27802215].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Delayed menarche [HP:0012569] Abnormal haematocrit [HP:0031850] Increased lactate dehydrogenase activity [HP:0025435] Reticulocytosis [HP:0001923] Anaemia [HP:0001903] |
Location
| Chromosome: | 7 |
|---|---|
| Locus: | NG_011992.1 |
| Locus Location: | 12965 |
| Size: | 1 bp |
| Located at: | NOS3 |
| Specific Location: | Exon 8 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | Indian, Greek, Portuguese |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Nishank SS, Endothelial Nitric Oxide Synthase (eNOS) Gene Polymorphism is Associated with Age Onset of Menarche in Sickle Cell Disease Females of India., Mediterr J Hematol Infect Dis , 5(1), e2013036, 2013
- Aguiar L, Matos A, Gil Â, Afonso C, Braga L, João L, Kjollerstrom P, Faustino P, Bicho M, Inácio Â, Sickle cell anemia - Nitric oxide related genetic modifiers of hematological and biochemical parameters., Clin. Hemorheol. Microcirc. , 2016
- Armenis I, Kalotychou V, Tzanetea R, Kollia P, Kontogeorgiou Z, Anastasopoulou D, Mantzourani M, Samarkos M, Pantos K, Konstantopoulos K, Rombos I, Prognostic value of T786C and G894T eNOS polymorphisms in sickle cell disease., Nitric Oxide , 62(0), 17-23, 2017
Created on 2016-08-09 14:34:02,
Last reviewed on 2019-12-23 11:21:31 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.