
IthaID: 2946
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs10901080 | HGVS Name: | NG_011542.1:g.43563G>T |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AGAAAGATGCTATTGTCCGTATCTC [G/T] GTGTACAAGGGGAACATGTCATTTG (Strand: +)
Comments: SNP associated with the HbF response to treatment with hydroxyurea in sickle cell disease/β-thalassaemia compound heterozygous patients (n=119).
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Hb F response to hydroxyurea |
Location
Chromosome: | 9 |
---|---|
Locus: | NG_011542.1 |
Locus Location: | 43563 |
Size: | 1 bp |
Located at: | ASS1 |
Specific Location: | Intron 12 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Greek |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Chalikiopoulou C, Tavianatou AG, Sgourou A, Kourakli A, Kelepouri D, Chrysanthakopoulou M, Kanelaki VK, Mourdoukoutas E, Siamoglou S, John A, Symeonidis A, Ali BR, Katsila T, Papachatzopoulou A, Patrinos GP, Genomic variants in the ASS1 gene, involved in the nitric oxide biosynthesis and signaling pathway, predict hydroxyurea treatment efficacy in compound sickle cell disease/β-thalassemia patients., Pharmacogenomics , 17(4), 393-403, 2016
Created on 2016-08-09 14:22:31,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.