IthaID: 2945
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs368698783 | HGVS Name: | NG_000007.3:g.47783G>A |
Context nucleotide sequence:
GTCTGGACTAGGAGCTTATTGATAA [C/T] CTCAGACGTTCCAGAAGCGAGTGTG (Strand: +)
Also known as: Aγ(+25 G>A)
Comments: The SNP (A allele) was associated with elevated HbF in β-thalassaemia patients from Egypt, Iraq, Iran and China. It is located in the 5'UTR sequence (+25) of the Aγ-globin gene, in a region that belongs to the binding site (5'-GGTTAT-3') of LYAR (human homologue of mouse Ly-1 antibody reactive clone), a putative repressor of γ-globin gene expression. It decreases the LYAR binding efficiency to the Aγ-globin gene. Different studies have shown that in β-thalassemia the Gγ-globin-XmnI(+)/Aγ-globin-(G>A) genotype is under genetic linkage with β0-thalassemia mutations. Experimental work has shown that the LYAR rs368698783 (G>A) polymorphism is associated with high basal and induced production of fetal haemoglobin in β-thalassaemia patients
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 47783 |
| Size: | 1 bp |
| Located at: | Aγ |
| Specific Location: | 5'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | 5'UTR (Transcription) |
| Ethnic Origin: | Egyptian, Iraqi, Iranian, Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Bianchi N, Cosenza LC, Lampronti I, Finotti A, Breveglieri G, Zuccato C, Fabbri E, Marzaro G, Chilin A, De Angelis G, Borgatti M, Gallucci C, Alfieri C, Ribersani M, Isgrò A, Marziali M, Gaziev J, Morrone A, Sodani P, Lucarelli G, Gambari R, Paciaroni K, Structural and Functional Insights on an Uncharacterized Aγ-Globin-Gene Polymorphism Present in Four β0-Thalassemia Families with High Fetal Hemoglobin Levels., Mol Diagn Ther , 20(2), 161-73, 2016
- Chen D, Zuo Y, Zhang X, Ye Y, Bao X, Huang H, Tepakhan W, Wang L, Ju J, Chen G, Zheng M, Liu D, Huang S, Zong L, Li C, Chen Y, Zheng C, Shi L, Zhao Q, Wu Q, Fucharoen S, Zhao C, Xu X, A Genetic Variant Ameliorates β-Thalassemia Severity by Epigenetic-Mediated Elevation of Human Fetal Hemoglobin Expression., Am. J. Hum. Genet. , 101(1), 130-138, 2017
- Breveglieri G, Bianchi N, Cosenza LC, Gamberini MR, Chiavilli F, Zuccato C, Montagner G, Borgatti M, Lampronti I, Finotti A, Gambari R, An Aγ-globin G->A gene polymorphism associated with β(0)39 thalassemia globin gene and high fetal hemoglobin production., BMC Med. Genet. , 18(1), 93, 2017
- Gemmo C, Breveglieri G, Marzaro G, Lampronti I, Cosenza LC, Gasparello J, Zuccato C, Fabbri E, Borgatti M, Chilin A, Finotti A, Gambari R, Surface plasmon resonance based analysis of the binding of LYAR protein to the rs368698783 (G>A) polymorphic Aγ-globin gene sequences mutated in β-thalassemia., Anal Bioanal Chem, 2019
- Jiang F, Li J, Zhou JY, Liao C, Li DZ, Regulatory Single Nucleotide Polymorphism rs368698783 (G>A): a Genetic Modifier of Hb F Production Only under Erythropoietic Stress Characteristic for β-Globin Chain Deficiency?, Hemoglobin, 43(1), 73-75, 2019
- Zuccato C, Cosenza LC, Zurlo M, Breveglieri G, Bianchi N, Lampronti I, Gasparello J, Scapoli C, Borgatti M, Finotti A, Gambari R, The rs368698783 (G>A) Polymorphism Affecting LYAR Binding to the Gene Is Associated with High Fetal Hemoglobin (HbF) in β-Thalassemia Erythroid Precursor Cells Treated with HbF Inducers., Int J Mol Sci, 24(1), 0, 2023