IthaID: 2943
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs2282786 | HGVS Name: | NG_011441.1:g.93457T>C |
Context nucleotide sequence:
CTGTAACCTTCCCCCAAAAGAGTCA [C/T] ATGCTCTAAGCCCTTTTCTACCACC (Strand: +)
Also known as:
Comments: SNP associated with a lower platelet count in the Kore Association Resource (KARE) project of the Korean Genome Epidemiology Study (KoGES; n=8842). The association was replicated in healthy samples from the Cardio Vascular Disease Association Study (CAVAS) of KoGES (n=3667) and the BioBank Japan cohort (n=23032).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Abnormal platelet count [HP:0011873] |
Location
| Chromosome: | 4 |
|---|---|
| Locus: | NG_011441.1 |
| Locus Location: | 93457 |
| Size: | 1 bp |
| Located at: | EGF |
| Specific Location: | Intron 21 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Korean, Japanese |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Kim YK, Oh JH, Kim YJ, Hwang MY, Moon S, Low SK, Takahashi A, Matsuda K, Kubo M, Lee J, Kim BJ, Influence of Genetic Variants in EGF and Other Genes on Hematological Traits in Korean Populations by a Genome-Wide Approach., Biomed Res Int , 2015(0), 914965, 2015
Created on 2016-08-09 12:54:19,
Last reviewed on 2019-12-10 10:21:52 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.