
IthaID: 2940
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs2280789 | HGVS Name: | NG_015990.1:g.5375T>C |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ATCTCCTGATCAGTTTTTCTGTCTT [C/T] AAGGTCTACACCCTCAAGGCCTACA (Strand: -)
Comments: The g.In1.1C variant associated with lower risk of bacterial infection recurrence in children with sickle cell disease (SCD) in Benin and in France (n=115) [PMID: 19425063]. The association was not replicated in an SCD cohort from Tunisia [PMID: 23900864].
External Links
Phenotype
Allele Phenotype (Cis): | Decreased expression for CCL5 |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Recurrent infections [HP:0002719] |
Location
Chromosome: | 17 |
---|---|
Locus: | NG_015990.1 |
Locus Location: | 5375 |
Size: | 1 bp |
Located at: | CCL5 |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Beninese, French |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Dossou-Yovo OP, Zaccaria I, Benkerrou M, Hauchecorne M, Alberti C, Rahimy MC, Elion J, Lapoumeroulie C, Effects of RANTES and MBL2 gene polymorphisms in sickle cell disease clinical outcomes: association of the g.In1.1T>C RANTES variant with protection against infections., Am. J. Hematol. , 84(6), 378-80, 2009
- Kalai M, Chaouch L, Mansour IB, Hafsia R, Ghanem A, Abbes S, Frequency of three polymorphisms of the CCL5 gene (rs2107538, rs2280788 and rs2280789) and their implications for the phenotypic expression of sickle cell anemia in Tunisia., Pol J Pathol , 64(2), 84-9, 2013
Created on 2016-08-09 11:07:12,
Last reviewed on 2019-07-03 22:19:50 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.