IthaID: 2939
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs2794452 | HGVS Name: | NC_000001.11:g.203468576T>C |
Context nucleotide sequence:
ATACATGTGCGTTTTCCAGGCTGTC [A/G] TCAAGAATGATTCTGATCTGTGCCC (Strand: -)
Also known as:
Comments: SNP associated with elevated tricuspid regurgitant jet velocity (TRV) in African Americans with sickle cell disease (49 cases; 63 controls). Elevated TRV has a positive predictive value for pulmonary hypertension.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Pulmonary arterial hypertension [HP:0002092] [OMIM:265400] |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Desai AA, Zhou T, Ahmad H, Zhang W, Mu W, Trevino S, Wade MS, Raghavachari N, Kato GJ, Peters-Lawrence MH, Thiruvoipati T, Turner K, Artz N, Huang Y, Patel AR, Yuan JX, Gordeuk VR, Lang RM, Garcia JG, Machado RF, A novel molecular signature for elevated tricuspid regurgitation velocity in sickle cell disease., Am. J. Respir. Crit. Care Med. , 186(4), 359-68, 2012
- Wonkam A, Makani J, Ofori-Aquah S, Nnodu OE, Treadwell M, Royal C, Ohene-Frempong K, , Sickle cell disease and H3Africa: enhancing genomic research on cardiovascular diseases in African patients., Cardiovasc J Afr , 26(2), S50-5, 2015
Created on 2016-08-09 11:00:50,
Last reviewed on (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-08-09 11:00:50 | The IthaGenes Curation Team | Created |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07