IthaID: 2933


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs799813 HGVS Name: NC_000002.12:g.154354666C>G

Context nucleotide sequence:
actcacttctgcaagcaccgtttat [C/G] gaagagaccacccttttccccattg (Strand: +)

Also known as:

Comments: SNP associated with elevated tricuspid regurgitant jet velocity (TRV) in African Americans with sickle cell disease (49 cases; 63 controls). Elevated TRV has a positive predictive value for pulmonary hypertension.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Pulmonary arterial hypertension [HP:0002092] [OMIM:265400]

Location

Chromosome: 2
Locus: N/A
Locus Location: N/A
Size: 1 bp
Located at: GALNT13
Specific Location: Intron 9

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Desai AA, Zhou T, Ahmad H, Zhang W, Mu W, Trevino S, Wade MS, Raghavachari N, Kato GJ, Peters-Lawrence MH, Thiruvoipati T, Turner K, Artz N, Huang Y, Patel AR, Yuan JX, Gordeuk VR, Lang RM, Garcia JG, Machado RF, A novel molecular signature for elevated tricuspid regurgitation velocity in sickle cell disease., Am. J. Respir. Crit. Care Med. , 186(4), 359-68, 2012
  2. Wonkam A, Makani J, Ofori-Aquah S, Nnodu OE, Treadwell M, Royal C, Ohene-Frempong K, , Sickle cell disease and H3Africa: enhancing genomic research on cardiovascular diseases in African patients., Cardiovasc J Afr , 26(2), S50-5, 2015
Created on 2016-08-09 10:11:18, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.