IthaID: 2931
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1044498 | HGVS Name: | NG_008206.1:g.48213A>C |
Context nucleotide sequence:
TGCCTGTTCAGATGACTGCAAGGAC [A/C] AGGGCGACTGCTGCATCAACTACAG (Strand: +)
Protein sequence:
MERDGCAGGGSRGGEGGRAPREGPAGNGRDRGRSHAAEAPGDPQAAASLLAPMDVGEEPLEKAARARTAKDPNTYKVLSLVLSVCVLTTILGCIFGLKPSCAKEVKSCKGRCFERTFGNCRCDAACVELGNCCLDYQETCIEPEHIWTCNKFRCGEKRLTRSLCACSDDCKDQGDCCINYSSVCQGEKSWVEEPCESINEPQCPAGFETPPTLLFSLDGFRAEYLHTWGGLLPVISKLKKCGTYTKNMRPVYPTKTFPNHYSIVTGLYPESHGIIDNKMYDPKMNASFSLKSKEKFNPEWYKGEPIWVTAKYQGLKSGTFFWPGSDVEINGIFPDIYKMYNGSVPFEERILAVLQWLQLPKDERPHFYTLYLEEPDSSGHSYGPVSSEVIKALQRVDGMVGMLMDGLKELNLHRCLNLILISDHGMEQGSCKKYIYLNKYLGDVKNIKVIYGPAARLRPSDVPDKYYSFNYEGIARNLSCREPNQHFKPYLKHFLPKRLHFAKSDRIEPLTFYLDPQWQLALNPSERKYCGSGFHGSDNVFSNMQALFVGYGPGFKHGIEADTFENIEVYNLMCDLLNLTPAPNNGTHGSLNHLLKNPVYTPKHPKEVHPLVQCPFTRNPRDNLGCSCNPSILPIEDFQTQFNLTVAEEKIIKHETLPYGRPRVLQKENTICLLSQHQFMSGYSQDILMPLWTSYTVDRNDSFSTEDFSNCLYQDFRIPLSPVHKCSFYKNNTKVSYGFLSPPQLNKNSSGIYSEALLTTNIVPMYQSFQVIWRYFHDTLLRKYAEERNGVNVVSGPVFDFDYDGRCDSLENLRQKRRVIRNQEILIPTHFFIVLTSCKDTSQTPLHCENLDTLAFILPHRTDNSESCVHGKHDSSWVEELLMLHRARITDVEHITGLSFYQQRKEPVSDILKLKTHLPTFSQED
Also known as: K173Q
Comments: The Q173 variant associated with a decreased risk of stroke in African American children with sickle cell disease (SCD) in both the discovery (120 cases; 104 controls) and validation (57 cases; 231 controls) cohorts. The association was replicated in two independent studies with pediatric SCD cohorts from Brazil, with K173 being the protective variant. rs1044498-A showed a positive association with stroke risk (that is, with high time averaged mean velocity (TAMMV) values obtained during transcranial Doppler (TCD) screening) in pediatric patients with sickle cell anemia of sub-Saharan African ancestry in Portugal.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Stroke [HP:0001297] [OMIM:601367] |
Location
| Chromosome: | 6 |
|---|---|
| Locus: | NG_008206.1 |
| Locus Location: | 48213 |
| Size: | 1 bp |
| Located at: | ENPP1 |
| Specific Location: | Exon 4 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | African American, Brazilian, sub-Saharan African |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Flanagan JM, Sheehan V, Linder H, Howard TA, Wang YD, Hoppe CC, Aygun B, Adams RJ, Neale GA, Ware RE, Genetic mapping and exome sequencing identify 2 mutations associated with stroke protection in pediatric patients with sickle cell anemia., Blood , 121(16), 3237-45, 2013
- Belisário AR, Sales RR, Toledo NE, Velloso-Rodrigues C, Silva CM, Viana MB, Association between ENPP1 K173Q and stroke in a newborn cohort of 395 Brazilian children with sickle cell anemia., Blood , 126(10), 1259-60, 2015
- Belisário AR, Sales RR, Toledo NE, Muniz MB, Velloso-Rodrigues C, Silva CM, Viana MB, Reticulocyte count is the most important predictor of acute cerebral ischemia and high-risk transcranial Doppler in a newborn cohort of 395 children with sickle cell anemia., Ann. Hematol. , 95(11), 1869-80, 2016
- Silva M, Vargas S, Coelho A, Ferreira E, Mendonça J, Vieira L, Maia R, Dias A, Ferreira T, Morais A, Soares IM, Lavinha J, Silva R, Kjöllerström P, Faustino P, Biomarkers and genetic modulators of cerebral vasculopathy in sub-Saharan ancestry children with sickle cell anemia., Blood Cells Mol Dis, 83(0), 102436, 2020