IthaID: 2931

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs1044498 HGVS Name: NG_008206.1:g.48213A>C

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TGCCTGTTCAGATGACTGCAAGGAC [A/C] AGGGCGACTGCTGCATCAACTACAG (Strand: +)

Protein sequence:
MERDGCAGGGSRGGEGGRAPREGPAGNGRDRGRSHAAEAPGDPQAAASLLAPMDVGEEPLEKAARARTAKDPNTYKVLSLVLSVCVLTTILGCIFGLKPSCAKEVKSCKGRCFERTFGNCRCDAACVELGNCCLDYQETCIEPEHIWTCNKFRCGEKRLTRSLCACSDDCKDQGDCCINYSSVCQGEKSWVEEPCESINEPQCPAGFETPPTLLFSLDGFRAEYLHTWGGLLPVISKLKKCGTYTKNMRPVYPTKTFPNHYSIVTGLYPESHGIIDNKMYDPKMNASFSLKSKEKFNPEWYKGEPIWVTAKYQGLKSGTFFWPGSDVEINGIFPDIYKMYNGSVPFEERILAVLQWLQLPKDERPHFYTLYLEEPDSSGHSYGPVSSEVIKALQRVDGMVGMLMDGLKELNLHRCLNLILISDHGMEQGSCKKYIYLNKYLGDVKNIKVIYGPAARLRPSDVPDKYYSFNYEGIARNLSCREPNQHFKPYLKHFLPKRLHFAKSDRIEPLTFYLDPQWQLALNPSERKYCGSGFHGSDNVFSNMQALFVGYGPGFKHGIEADTFENIEVYNLMCDLLNLTPAPNNGTHGSLNHLLKNPVYTPKHPKEVHPLVQCPFTRNPRDNLGCSCNPSILPIEDFQTQFNLTVAEEKIIKHETLPYGRPRVLQKENTICLLSQHQFMSGYSQDILMPLWTSYTVDRNDSFSTEDFSNCLYQDFRIPLSPVHKCSFYKNNTKVSYGFLSPPQLNKNSSGIYSEALLTTNIVPMYQSFQVIWRYFHDTLLRKYAEERNGVNVVSGPVFDFDYDGRCDSLENLRQKRRVIRNQEILIPTHFFIVLTSCKDTSQTPLHCENLDTLAFILPHRTDNSESCVHGKHDSSWVEELLMLHRARITDVEHITGLSFYQQRKEPVSDILKLKTHLPTFSQED

Comments: The Q173 variant associated with a decreased risk of stroke in African American children with sickle cell disease (SCD) in both the discovery (120 cases; 104 controls) and validation (57 cases; 231 controls) cohorts. The association was replicated in two independent studies with pediatric SCD cohorts from Brazil, with K173 being the protective variant. rs1044498-A showed a positive association with stroke risk (that is, with high time averaged mean velocity (TAMMV) values obtained during transcranial Doppler (TCD) screening) in pediatric patients with sickle cell anemia of sub-Saharan African ancestry in Portugal.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Stroke [HP:0001297] [OMIM:601367]

Location

Chromosome: 6
Locus: NG_008206.1
Locus Location: 48213
Size: 1 bp
Located at: ENPP1
Specific Location: Exon 4

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: African American, Brazilian, sub-Saharan African
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Flanagan JM, Sheehan V, Linder H, Howard TA, Wang YD, Hoppe CC, Aygun B, Adams RJ, Neale GA, Ware RE, Genetic mapping and exome sequencing identify 2 mutations associated with stroke protection in pediatric patients with sickle cell anemia., Blood , 121(16), 3237-45, 2013
  2. Belisário AR, Sales RR, Toledo NE, Velloso-Rodrigues C, Silva CM, Viana MB, Association between ENPP1 K173Q and stroke in a newborn cohort of 395 Brazilian children with sickle cell anemia., Blood , 126(10), 1259-60, 2015
  3. Belisário AR, Sales RR, Toledo NE, Muniz MB, Velloso-Rodrigues C, Silva CM, Viana MB, Reticulocyte count is the most important predictor of acute cerebral ischemia and high-risk transcranial Doppler in a newborn cohort of 395 children with sickle cell anemia., Ann. Hematol. , 95(11), 1869-80, 2016
  4. Silva M, Vargas S, Coelho A, Ferreira E, Mendonça J, Vieira L, Maia R, Dias A, Ferreira T, Morais A, Soares IM, Lavinha J, Silva R, Kjöllerström P, Faustino P, Biomarkers and genetic modulators of cerebral vasculopathy in sub-Saharan ancestry children with sickle cell anemia., Blood Cells Mol Dis, 83(0), 102436, 2020
Created on 2016-08-09 09:50:44, Last reviewed on 2022-03-24 11:43:08 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.