IthaID: 2928


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs876687 HGVS Name: NG_007490.1:g.82652T>C

Context nucleotide sequence:
GCCTTAATGGCCATAGTAGGAAAAA [C/T] GAGCAATGTTGCCTGATCGCTGCAA (Strand: +)

Also known as:

Comments: SNP associated with risk of stroke in individuals with sickle cell disease.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Stroke [HP:0001297] [OMIM:601367]

Location

Chromosome: 3
Locus: NG_007490.1
Locus Location: 82652
Size: 1 bp
Located at: TGFBR2
Specific Location: Intron 6

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Fertrin KY, Costa FF, Genomic polymorphisms in sickle cell disease: implications for clinical diversity and treatment., Expert Rev Hematol , 3(4), 443-58, 2010
Created on 2016-06-07 09:40:40, Last reviewed on 2016-07-01 15:02:19 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.