IthaID: 2926
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs4953354 | HGVS Name: | NG_016000.1:g.55848A>G |
Context nucleotide sequence:
GACAAGAGCAGGAGAGCCAAGGGGG [A/G] AGATATGCTCCATAAATACTTTCAA (Strand: +)
Also known as:
Comments: SNP associated with haemoglobin levels in Tibetans living at high altitudes (n=70).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Anaemia [HP:0001903] |
Location
| Chromosome: | 2 |
|---|---|
| Locus: | NG_016000.1 |
| Locus Location: | 55848 |
| Size: | 1 bp |
| Located at: | EPAS1 |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Tibetan |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Beall CM, Cavalleri GL, Deng L, Elston RC, Gao Y, Knight J, Li C, Li JC, Liang Y, McCormack M, Montgomery HE, Pan H, Robbins PA, Shianna KV, Tam SC, Tsering N, Veeramah KR, Wang W, Wangdui P, Weale ME, Xu Y, Xu Z, Yang L, Zaman MJ, Zeng C, Zhang L, Zhang X, Zhaxi P, Zheng YT, Natural selection on EPAS1 (HIF2alpha) associated with low hemoglobin concentration in Tibetan highlanders., Proc. Natl. Acad. Sci. U.S.A. , 107(25), 11459-64, 2010
Created on 2016-06-07 09:27:08,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.