IthaID: 2924


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs4786504 HGVS Name: NC_000016.10:g.4487692T>C

Context nucleotide sequence:
gctggcgcctgtagtcccagctcct [C/T] gggaggctgaggtgggagaatggcg (Strand: +)

Also known as:

Comments: SNP associated with haemoglobin (Hb) levels in Tibetans living at high altitudes. The association was significant only in males, not in females.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Anaemia [HP:0001903]

Location

Chromosome: 16
Locus: N/A
Locus Location: N/A
Size: 1 bp
Located at: HMOX2
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Tibetan, Han Chinese
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Yang D, Peng Y, Ouzhuluobu , Bianbazhuoma , Cui C, Bianba , Wang L, Xiang K, He Y, Zhang H, Zhang X, Liu J, Shi H, Pan Y, Duojizhuoma , Dejiquzong , Cirenyangji , Baimakangzhuo , Gonggalanzi , Liu S, Gengdeng , Wu T, Chen H, Qi X, Su B, HMOX2 Functions as a Modifier Gene for High-Altitude Adaptation in Tibetans., Hum. Mutat. , 37(2), 216-23, 2016
Created on 2016-06-06 15:29:22, Last reviewed on 2016-06-06 17:38:51 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.