IthaID: 2922
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1800797 | HGVS Name: | NG_011640.1:g.4456A>G |
Context nucleotide sequence:
TGAAGTAACTGCACGAAATTTGAGG [A/G] TGGCCAGGCAGTTCTACAACAGCCG (Strand: +)
Also known as: -597G>A
Comments: SNP (A allele) associated with a protective effect against retinopathy in patients with sickle cell anaemia (SCA) from Brazil.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Retinopathy [HP:0000488] |
Location
| Chromosome: | 7 |
|---|---|
| Locus: | NG_011640.1 |
| Locus Location: | 4456 |
| Size: | 1 bp |
| Located at: | IL6 |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Brazilian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Vicari P, Adegoke SA, Mazzotti DR, Cançado RD, Nogutti MA, Figueiredo MS, Interleukin-1β and interleukin-6 gene polymorphisms are associated with manifestations of sickle cell anemia., Blood Cells Mol. Dis. , 54(3), 244-9, 2015
Created on 2016-05-26 12:04:00,
Last reviewed on 2017-07-19 11:01:06 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.