IthaID: 2920


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs17599586 HGVS Name: NG_007086.2:g.15355C>T

Context nucleotide sequence:
TCCTTGACCTGAAACCAAGTCCCAG [C/T] TGACACTTTCAGAATGTCCATCAGT (Strand: +)

Also known as:

Comments: SNP associated with variation in HbF levels in pediatric patients with sickle cell disease receiving hydroxyurea treatment, who were recruited from the Hydroxyurea Study of Long-Term Effects (HUSTLE; n=174).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F response to hydroxyurea

Location

Chromosome: 6
Locus: NG_007086.2
Locus Location: 15355
Size: 1 bp
Located at: ARG1
Specific Location: Intron 7

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Ware RE, Despotovic JM, Mortier NA, Flanagan JM, He J, Smeltzer MP, Kimble AC, Aygun B, Wu S, Howard T, Sparreboom A, Pharmacokinetics, pharmacodynamics, and pharmacogenetics of hydroxyurea treatment for children with sickle cell anemia., Blood , 118(18), 4985-91, 2011
  2. Green NS, Barral S, Emerging science of hydroxyurea therapy for pediatric sickle cell disease., Pediatr. Res. , 75(1), 196-204, 2014
Created on 2016-05-25 16:12:22, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.