
IthaID: 2918
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs4282891 | HGVS Name: | NC_000010.11:g.70170313A>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ACCGCCTGCGTGTCACTTCCCCCCC [A>G] CCCAACCCCGCCAGGGCCAGCCTCC (Strand: +)
Comments: SNP associated with a significant change in HbF levels after 2 years of hydroxyurea (HU) treatment in African Americans with sickle cell disease (SCD) acquired from the Sickle Cell Pulmonary Hypertension Screening Study (n=32). SNP did not associate with baseline HbF in SCD patients from Cameroon, without any HU treatment (n=484).
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Hb F response to hydroxyurea |
Location
Chromosome: | 10 |
---|---|
Locus: | NM_001142648.2 |
Locus Location: | N/A |
Size: | 1 bp |
Located at: | SAR1A |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Kumkhaek C, Taylor JG, Zhu J, Hoppe C, Kato GJ, Rodgers GP, Fetal haemoglobin response to hydroxycarbamide treatment and sar1a promoter polymorphisms in sickle cell anaemia., Br. J. Haematol. , 141(2), 254-9, 2008
- Green NS, Barral S, Emerging science of hydroxyurea therapy for pediatric sickle cell disease., Pediatr. Res. , 75(1), 196-204, 2014
- Pule GD, Bitoungui VJN, Chemegni BC, Kengne AP, Wonkam A, SAR1a promoter polymorphisms are not associated with fetal hemoglobin in patients with sickle cell disease from Cameroon., BMC Res Notes , 10(1), 183, 2017
Created on 2016-05-24 18:16:06,
Last reviewed on 2019-12-12 15:34:59 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.