IthaID: 2911
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | Sp1 polymorphism | HGVS Name: | NG_007400.1:g.6252G>T |
Context nucleotide sequence:
CGCCACCCCACCTGCCCAGGGAATG [G/T] GGGCGGGATGAGGGCTGGACCTCCC (Strand: -)
Also known as: rs1800012
Comments: The Sp1 polymorphism associated with low bone mineral density and predisposition to osteoporosis in β-thalassaemia major cohorts from Italy (n=135) and Turkey (37 cases; 92 controls).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Osteoporosis [HP:0000939] [OMIM:166710] |
Location
Chromosome: | 17 |
---|---|
Locus: | NG_007400.1 |
Locus Location: | 6252 |
Size: | 1 bp |
Located at: | COL1A1 |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Italian, Turkish |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Arisal O, Deviren A, Fenerci EY, Hacihanefioglu S, Ulutin T, Erkmen S, Buyru N, Polymorphism analysis in the COLIA1 gene of patients with thalassemia major and intermedia., Haematologia (Budap) , 32(4), 475-82, 2002
- Guzeloglu-Kayisli O, Cetin Z, Keser I, Ozturk Z, Tuncer T, Canatan D, Luleci G, Relationship between SP1 polymorphism and osteoporosis in beta-thalassemia major patients., Pediatr Int , 50(4), 474-6, 2008
- Hamed HM, Galal A, Ghamrawy ME, Abd El Azeem K, Hussein IR, Abd-Elgawad MF, An SP1-binding site polymorphism in the COLIAI gene and osteoporosis in Egyptian patients with thalassemia major., Blood Coagul. Fibrinolysis , 22(2), 81-5, 2011
Created on 2016-05-23 17:46:54,
Last reviewed on 2016-05-23 17:48:17 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-05-23 17:46:54 | The IthaGenes Curation Team | Created |
2 | 2016-05-23 17:48:17 | The IthaGenes Curation Team | Reviewed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07