IthaID: 2911


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: Sp1 polymorphism HGVS Name: NG_007400.1:g.6252G>T

Context nucleotide sequence:
CGCCACCCCACCTGCCCAGGGAATG [G/T] GGGCGGGATGAGGGCTGGACCTCCC (Strand: -)

Also known as: rs1800012

Comments: The Sp1 polymorphism associated with low bone mineral density and predisposition to osteoporosis in β-thalassaemia major cohorts from Italy (n=135) and Turkey (37 cases; 92 controls).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Osteoporosis [HP:0000939] [OMIM:166710]

Location

Chromosome: 17
Locus: NG_007400.1
Locus Location: 6252
Size: 1 bp
Located at: COL1A1
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Italian, Turkish
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Arisal O, Deviren A, Fenerci EY, Hacihanefioglu S, Ulutin T, Erkmen S, Buyru N, Polymorphism analysis in the COLIA1 gene of patients with thalassemia major and intermedia., Haematologia (Budap) , 32(4), 475-82, 2002
  2. Guzeloglu-Kayisli O, Cetin Z, Keser I, Ozturk Z, Tuncer T, Canatan D, Luleci G, Relationship between SP1 polymorphism and osteoporosis in beta-thalassemia major patients., Pediatr Int , 50(4), 474-6, 2008
  3. Hamed HM, Galal A, Ghamrawy ME, Abd El Azeem K, Hussein IR, Abd-Elgawad MF, An SP1-binding site polymorphism in the COLIAI gene and osteoporosis in Egyptian patients with thalassemia major., Blood Coagul. Fibrinolysis , 22(2), 81-5, 2011
Created on 2016-05-23 17:46:54, Last reviewed on 2016-05-23 17:48:17 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.