IthaID: 2910
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | BsmI polymorphism | HGVS Name: | NG_008731.1:g.63980G>A |
Context nucleotide sequence:
TTCCTGGGGCCACAGACAGGCCTGC [A/G] CATTCCCAATACTCAGGCTCTGCTC (Strand: -)
Also known as: rs1544410
Comments: SNP associated with bone mineral density in individuals with β-thalassaemia (n=42).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Osteoporosis [HP:0000939] [OMIM:166710] |
Location
| Chromosome: | 12 |
|---|---|
| Locus: | NG_008731.1 |
| Locus Location: | 63980 |
| Size: | 1 bp |
| Located at: | VDR |
| Specific Location: | Intron 9 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- El-Edel RH, Ghonaim MM, Abo-Salem OM, El-Nemr FM, Bone mineral density and vitamin D receptor polymorphism in beta-thalassemia major., Pak J Pharm Sci , 23(1), 89-96, 2010
Created on 2016-05-23 17:03:17,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.