IthaID: 2909


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs11969912 HGVS Name: NG_008107.1:g.149950C>T

Context nucleotide sequence:
TTTTGAGGGACATCTGTTGACAGGC [A/G] GTGGTGCACCTAAGTTCTAATGCAG (Strand: +)

Also known as: hcv1860621

Comments: SNP associated with priapism in male patients with sickle cell disease (n=199).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Priapism [HP:0200023] [OMIM:176620]

Location

Chromosome: 6
Locus: NG_008107.1
Locus Location: 149950
Size: 1 bp
Located at: F13A1
Specific Location: Intron 11

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Elliott L, Ashley-Koch AE, De Castro L, Jonassaint J, Price J, Ataga KI, Levesque MC, Brice Weinberg J, Eckman JR, Orringer EP, Vance JM, Telen MJ, Genetic polymorphisms associated with priapism in sickle cell disease., Br. J. Haematol. , 137(3), 262-7, 2007
Created on 2016-05-23 15:30:53, Last reviewed on 2016-05-23 15:32:02 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.