IthaID: 2908
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1624292 | HGVS Name: | NG_029954.1:g.65626T>C |
Context nucleotide sequence:
GAGGAAGTTAGAGGTGGGATATTAG [C/T] GGTGAAGTTGGTAGAACCTCAGCTG (Strand: +)
Also known as:
Comments: SNP associated with pulmonary hypertension in individuals with sickle cell disease (59 cases; 107 controls)
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Pulmonary arterial hypertension [HP:0002092] [OMIM:265400] |
Location
| Chromosome: | 18 |
|---|---|
| Locus: | NG_029954.1 |
| Locus Location: | 65626 |
| Size: | 1 bp |
| Located at: | NEDD4L |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Fertrin KY, Costa FF, Genomic polymorphisms in sickle cell disease: implications for clinical diversity and treatment., Expert Rev Hematol , 3(4), 443-58, 2010
Created on 2016-05-23 15:10:30,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.