IthaID: 2908

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs1624292 HGVS Name: NG_029954.1:g.65626T>C

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GAGGAAGTTAGAGGTGGGATATTAG [C/T] GGTGAAGTTGGTAGAACCTCAGCTG (Strand: +)

Comments: SNP associated with pulmonary hypertension in individuals with sickle cell disease (59 cases; 107 controls)

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Pulmonary arterial hypertension [HP:0002092] [OMIM:265400]

Location

Chromosome: 18
Locus: NG_029954.1
Locus Location: 65626
Size: 1 bp
Located at: NEDD4L
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Fertrin KY, Costa FF, Genomic polymorphisms in sickle cell disease: implications for clinical diversity and treatment., Expert Rev Hematol , 3(4), 443-58, 2010
Created on 2016-05-23 15:10:30, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.