IthaID: 2897
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs5923 | HGVS Name: | NG_009778.1:g.9063C>T |
Context nucleotide sequence:
GGGCCGCCAGCCACAGCCTGTGCAC [C/T] TGCTGCCCCTGCACGGGATACAGCA (Strand: -)
Protein sequence:
MGPPGSPWQWVTLLLGLLLPPAAPFWLLNVLFPPHTTPKAELSNHTRPVILVPGCLGNQLEAKLDKPDVVNWMCYRKTEDFFTIWLDLNMFLPLGVDCWIDNTRVVYNRSSGLVSNAPGVQIRVPGFGKTYSVEYLDSSKLAGYLHTLVQNLVNNGYVRDETVRAAPYDWRLEPGQQEEYYRKLAGLVEEMHAAYGKPVFLIGHSLGCLHLLYFLLRQPQAWKDRFIDGFISLGAPWGGSIKPMLVLASGDNQGIPIMSSIKLKEEQRITTTSPWMFPSRMAWPEDHVFISTPSFNYTGRDFQRFFADLHFEEGWYMWLQSRDLLAGLPAPGVEVYCLYGVGLPTPRTYIYDHGFPYTDPVGVLYEDGDDTVATRSTELCGLWQGRQPQPVHLLPLHGIQHLNMVFSNLTLEHINAILLGAYRQGPPASPTASPEPPPPE
Also known as:
Comments: SNP associated with risk of pulmonary hypertension in individuals with sickle cell disease acquired from outpatient clinics at the Duke University Medical Center and the University of North Carolina Chapel Hill (n=581).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Pulmonary arterial hypertension [HP:0002092] [OMIM:265400] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_009778.1 |
| Locus Location: | 9063 |
| Size: | 1 bp |
| Located at: | LCAT |
| Specific Location: | Exon 6 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Ashley-Koch AE, Elliott L, Kail ME, De Castro LM, Jonassaint J, Jackson TL, Price J, Ataga KI, Levesque MC, Weinberg JB, Orringer EP, Collins A, Vance JM, Telen MJ, Identification of genetic polymorphisms associated with risk for pulmonary hypertension in sickle cell disease., Blood , 111(12), 5721-6, 2008
- Driss A, Asare KO, Hibbert JM, Gee BE, Adamkiewicz TV, Stiles JK, Sickle Cell Disease in the Post Genomic Era: A Monogenic Disease with a Polygenic Phenotype., Genomics Insights , 2009(2), 23-48, 2009