IthaID: 2889
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs2076192 | HGVS Name: | NC_000006.12:g.136377559C>A |
Context nucleotide sequence:
GGAGAGGCTTCATCAGCCTGCCTGG [A/C] GTCTGGTGTCCAGATAAGATGCTAA (Strand: +)
Also known as:
Comments: SNP associated with HbF level variation in the Multicenter Study of Hydroxyurea in SCA (n=280).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Wyszynski DF, Baldwin CT, Cleves MA, Amirault Y, Nolan VG, Farrell JJ, Bisbee A, Kutlar A, Farrer LA, Steinberg MH, Polymorphisms near a chromosome 6q QTL area are associated with modulation of fetal hemoglobin levels in sickle cell anemia., Cell. Mol. Biol. (Noisy-le-grand) , 50(1), 23-33, 2004
- Driss A, Asare KO, Hibbert JM, Gee BE, Adamkiewicz TV, Stiles JK, Sickle Cell Disease in the Post Genomic Era: A Monogenic Disease with a Polygenic Phenotype., Genomics Insights , 2009(2), 23-48, 2009
Created on 2016-05-23 09:15:38,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.