IthaID: 2886


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs243027 HGVS Name: NC_000002.12:g.60379872T>G

Context nucleotide sequence:
TATGGTGATAAACTTCATTGATAAA [A/C] GGAAAGTGAAACTTAAAACATTAAC (Strand: -)

Also known as:

Comments: SNP associated with F-cell variation in healthy Northern Europeans (TwinUK cohort) [PMID: 17767159]. The association was not replicated in Chinese, Thai and African American subjects [PMID: 18691915].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: F-cell numbers

Location

Chromosome: 2
Locus: N/A
Locus Location: N/A
Size: 1 bp
Located at: MIR4432HG
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Nortern European
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Menzel S, Garner C, Gut I, Matsuda F, Yamaguchi M, Heath S, Foglio M, Zelenika D, Boland A, Rooks H, Best S, Spector TD, Farrall M, Lathrop M, Thein SL, A QTL influencing F cell production maps to a gene encoding a zinc-finger protein on chromosome 2p15., Nat. Genet. , 39(10), 1197-9, 2007
  2. Sedgewick AE, Timofeev N, Sebastiani P, So JC, Ma ES, Chan LC, Fucharoen G, Fucharoen S, Barbosa CG, Vardarajan BN, Farrer LA, Baldwin CT, Steinberg MH, Chui DH, BCL11A is a major HbF quantitative trait locus in three different populations with beta-hemoglobinopathies., Blood Cells Mol. Dis. , 41(3), 255-8, 2008
Created on 2016-05-19 16:21:25, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.