IthaID: 2870


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs968856 HGVS Name: NG_000007.3:g.58270A>G

Context nucleotide sequence:
ATTATGAGTATTACACTATCCATAG [A/G] GAAGTTTGTTTGAGACCTAAACTGA (Strand: -)

Also known as:

Comments: SNP associated with HbF level variation in the general (non-anaemic) population of Sardinia (n=4305). SNP associated with disease severity and HbF levels in Thai β0-thalassaemia/HbE patients.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 58270
Size: 1 bp
Located at: HBD-HBBP1
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Sardinian, Thai
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Publications / Origin

  1. Uda M, Galanello R, Sanna S, Lettre G, Sankaran VG, Chen W, Usala G, Busonero F, Maschio A, Albai G, Piras MG, Sestu N, Lai S, Dei M, Mulas A, Crisponi L, Naitza S, Asunis I, Deiana M, Nagaraja R, Perseu L, Satta S, Cipollina MD, Sollaino C, Moi P, Hirschhorn JN, Orkin SH, Abecasis GR, Schlessinger D, Cao A, Genome-wide association study shows BCL11A associated with persistent fetal hemoglobin and amelioration of the phenotype of beta-thalassemia., Proc. Natl. Acad. Sci. U.S.A. , 105(5), 1620-5, 2008
  2. Nuinoon M, Makarasara W, Mushiroda T, Setianingsih I, Wahidiyat PA, Sripichai O, Kumasaka N, Takahashi A, Svasti S, Munkongdee T, Mahasirimongkol S, Peerapittayamongkol C, Viprakasit V, Kamatani N, Winichagoon P, Kubo M, Nakamura Y, Fucharoen S, A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E., Hum. Genet. , 127(3), 303-14, 2010
Created on 2016-05-18 17:45:12, Last reviewed on 2016-09-27 16:51:19 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.