
IthaID: 2867
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs8175347 | HGVS Name: | NG_002601.2:g.175492_175493TA[5][6][7][8] |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TTGGTGTATCGATTGGTTTTTGCCA [(TA)5/6/7/8] AGTAGGAGAGGGCGAACCTCTGGCA (Strand: +)
Comments: SNP associated with risk of cholelithiasis and variation in bilirubin levels in the Cooperative Study of Sickle Cell Disease (CSSCD; n=276), in the BABY HUG cohort (n=190), in individuals from Portugal with African descend (n=153), and in sickle cell disease (SCD) cohorts from France (n=158), Guadeloupe (n=324), Jamaica (n=209), Tunisia (n=102) and Saudi Arabia (n=223). The co-inheritance of alpha thalassemia was shown to lower the risk of gallstones in the Saudi cohort. Also, the TA7/TA7 genotype associated with hyperbilirubinemia in patients with SCD from Southern Brazil (n=72). It has shown high prevalence in SCD patients from French Guiana. The UGT1A1 (TA)6/(TA)8 heterozygote showed positive associations with HbA2, HbF, and Hb levels, PCV values, and RBC counts in a sickle cell disease cohort from Jamaica (n=371). The UGT1A1*28 variant allele (also known as the (TA)7 allele) is characterized by the presence of seven thymine-adenine (TA) repeats in the TATA sequence of the UGT1A1 promoter, as opposed to six that characterize the wild-type allele, and leads to reduced gene expression and enzyme levels. This SNP overlaps the UGT1A3, UGT1A4, UGT1A5, UGT1A6, UGT1A7, UGT1A8, UGT1A9 and UGT1A10 genes within the UGT1A locus.
External Links
Phenotype
Allele Phenotype (Cis): | Decreased expression for UGT1A1 |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] Gallstones [HP:0001081] [OMIM:600803] Bilirubin levels Abnormal red blood cell count [HP:0020058] Anaemia [HP:0001903] |
Location
Chromosome: | 2 |
---|---|
Locus: | NG_002601.2 |
Locus Location: | 175492 |
Size: | 2 bp |
Located at: | UGT1A1 |
Specific Location: | Promoter |
Other details
Type of Mutation: | Point-Mutation(Insertion) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American, Guadeloupean, Jamaican, Portuguese, Guianese, Tunisian, Saudi, French, Brazilian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Chaar V, Kéclard L, Diara JP, Leturdu C, Elion J, Krishnamoorthy R, Clayton J, Romana M, Association of UGT1A1 polymorphism with prevalence and age at onset of cholelithiasis in sickle cell anemia., Haematologica , 90(2), 188-99, 2005
- Haverfield EV, McKenzie CA, Forrester T, Bouzekri N, Harding R, Serjeant G, Walker T, Peto TE, Ward R, Weatherall DJ, UGT1A1 variation and gallstone formation in sickle cell disease., Blood , 105(3), 968-72, 2005
- Carpenter SL, Lieff S, Howard TA, Eggleston B, Ware RE, UGT1A1 promoter polymorphisms and the development of hyperbilirubinemia and gallbladder disease in children with sickle cell anemia., Am. J. Hematol. , 83(10), 800-3, 2008
- Martins R, Morais A, Dias A, Soares I, Rolão C, Ducla-Soares JL, Braga L, Seixas T, Nunes B, Olim G, Romão L, Lavinha J, Faustino P, Early modification of sickle cell disease clinical course by UDP-glucuronosyltransferase 1A1 gene promoter polymorphism., J. Hum. Genet. , 53(6), 524-8, 2008
- Sheehan VA, Luo Z, Flanagan JM, Howard TA, Thompson BW, Wang WC, Kutlar A, Ware RE, , Genetic modifiers of sickle cell anemia in the BABY HUG cohort: influence on laboratory and clinical phenotypes., Am. J. Hematol. , 88(7), 571-6, 2013
- Chaouch L, Talbi E, Moumni I, Ben Chaabene A, Kalai M, Chaouachi D, Mallouli F, Ghanem A, Abbes S, Early complication in Sickle Cell Anemia children due to A(TA)
_n TAA polymorphism at the promoter of UGT1A1 gene., Dis. Markers , 2013 - Chaouch L, Talbi E, Moumni I, Ben Chaabene A, Kalai M, Chaouachi D, Mallouli F, Ghanem A, Abbes S, Early complication in sickle cell anemia children due to A(TA)nTAA polymorphism at the promoter of UGT1A1 gene., Dis. Markers , 35(2), 67-72, 2013
- Hamad Z, Aljedai A, Halwani R, AlSultan A, UGT1A1 promoter polymorphism associated with serum bilirubin level in Saudi patients with sickle cell disease., Ann Saudi Med , 33(4), 372-6, 2013
- Christine S, Narcisse E, Philippe J, Tania V, Mathieu N, Genetic modulators of sickle cell disease in French Guiana: Markers of the slave trade., Am. J. Hum. Biol. , 2016
- Joly P, Renoux C, Lacan P, Bertrand Y, Cannas G, Garnier N, Cuzzubbo D, Kebaïli K, Renard C, Gauthier A, Pialoux V, Martin C, Romana M, Connes P, UGT1A1 (TA)n genotype is not the major risk factor of cholelithiasis in sickle cell disease children., Eur. J. Haematol. , 98(3), 296-301, 2017
- de Azevedo LA, Bonazzoni J, Wagner SC, Farias MG, Bittar CM, Daudt L, de Castro SM, Do Alpha Thalassemia, Fetal Hemoglobin, and the UGT1A1 Polymorphism have an Influence on Serum Bilirubin Levels and Cholelithiasis in Patients with Sickle Cell Disease?, Mol Diagn Ther , 2017
- Howell S, Marshall K, Reid M, McFarlane-Anderson N, McKenzie C, A cross-sectional clinic-based study exploring whether variants within the glutathione S-transferase, haptoglobin and uridine 5'-diphospho-glucuronosyltransferase 1A1 genes are associated with interindividual phenotypic variation in sickle cell anaemia in Jamaica., Eur. J. Haematol. , 2017