IthaID: 2866
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs3755319 | HGVS Name: | NG_002601.2:g.174193A>C |
Context nucleotide sequence:
CATTTGGGGAAATTCTGATGACTGA [G/T] TTGAAGTCAAAAGGGAAAGATGAGC (Strand: -)
Also known as:
Comments: SNP associated with risk of cholelithiasis and variation in bilirubin levels in the Cooperative Study of Sickle Cell Disease (CSSCD; n=1117). The association with bilirubin levels was replicated in three independent studies, namely, the Pulmonary Hypertension and Sickle Cell Disease with Sildenafil Therapy (Walk-PHaSST; n=522), the Outcome Modifying Genes study (n=530) and the SITT silent cerebral infarct trial (n=905). This SNP overlaps the UGT1A3, UGT1A4, UGT1A5, UGT1A6, UGT1A7, UGT1A8, UGT1A9 and UGT1A10 genes within the UGT1A locus.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Gallstones [HP:0001081] [OMIM:600803] Bilirubin levels |
Location
Chromosome: | 2 |
---|---|
Locus: | NG_002601.2 |
Locus Location: | 174193 |
Size: | 1 bp |
Located at: | UGT1A10 |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Milton JN, Sebastiani P, Solovieff N, Hartley SW, Bhatnagar P, Arking DE, Dworkis DA, Casella JF, Barron-Casella E, Bean CJ, Hooper WC, DeBaun MR, Garrett ME, Soldano K, Telen MJ, Ashley-Koch A, Gladwin MT, Baldwin CT, Steinberg MH, Klings ES, A genome-wide association study of total bilirubin and cholelithiasis risk in sickle cell anemia., PLoS ONE , 7(4), e34741, 2012
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-05-18 16:23:41 | The IthaGenes Curation Team | Created |
2 | 2016-05-18 16:26:16 | The IthaGenes Curation Team | Reviewed. |