IthaID: 2860
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs17863787 | HGVS Name: | NG_002601.2:g.117705T>G |
Context nucleotide sequence:
TCTTCCTTTCTAATAAGGATAACAT [G/T] TATTTCTTTTGCTTATCTAATTGCC (Strand: +)
Also known as:
Comments: SNP associated with variation in bilirubin levels in the Cooperative Study of Sickle Cell Disease (CSSCD; n=1117). The association was replicated in three independent studies, namely, the Pulmonary Hypertension and Sickle Cell Disease with Sildenafil Therapy (Walk-PHaSST; n=522), the Outcome Modifying Genes study (n=530) and the SITT silent cerebral infarct trial (n=905). This SNP overlaps the UGT1A6, UGT1A7, UGT1A8, UGT1A9 and UGT1A10 genes within the UGT1A locus.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Bilirubin levels |
Location
Chromosome: | 2 |
---|---|
Locus: | NG_002601.2 |
Locus Location: | 117705 |
Size: | 1 bp |
Located at: | UGT1A10 |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Milton JN, Sebastiani P, Solovieff N, Hartley SW, Bhatnagar P, Arking DE, Dworkis DA, Casella JF, Barron-Casella E, Bean CJ, Hooper WC, DeBaun MR, Garrett ME, Soldano K, Telen MJ, Ashley-Koch A, Gladwin MT, Baldwin CT, Steinberg MH, Klings ES, A genome-wide association study of total bilirubin and cholelithiasis risk in sickle cell anemia., PLoS ONE , 7(4), e34741, 2012
Created on 2016-05-18 15:50:45,
Last reviewed on 2016-05-18 15:53:01 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-05-18 15:50:45 | The IthaGenes Curation Team | Created |
2 | 2016-05-18 15:53:01 | The IthaGenes Curation Team | Reviewed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07