IthaID: 2854


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs10168155 HGVS Name: NG_002601.2:g.103447C>T

Context nucleotide sequence:
TCATGGAAATGGAAGCCTTTATGAC [C/T] GGCTTCTTTCACTTAGTTTTGTGGC (Strand: +)

Also known as:

Comments: SNP associated with risk of cholelithiasis and variation in bilirubin levels in the Cooperative Study of Sickle Cell Disease (CSSCD; n=1117). The association with bilirubin levels was replicated in three independent studies, namely the Pulmonary Hypertension and Sickle Cell Disease with Sildenafil Therapy (Walk-PHaSST; n=522), the Outcome Modifying Genes study (n=530), and the SITT silent cerebral infarct trial (n=905). This SNP overlaps the UGT1A7, UGT1A8, UGT1A9 and UGT1A10 genes within the UGT1A locus.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Gallstones [HP:0001081] [OMIM:600803]
Bilirubin levels

Location

Chromosome: 2
Locus: NG_002601.2
Locus Location: 103447
Size: 1 bp
Located at: UGT1A10
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Milton JN, Sebastiani P, Solovieff N, Hartley SW, Bhatnagar P, Arking DE, Dworkis DA, Casella JF, Barron-Casella E, Bean CJ, Hooper WC, DeBaun MR, Garrett ME, Soldano K, Telen MJ, Ashley-Koch A, Gladwin MT, Baldwin CT, Steinberg MH, Klings ES, A genome-wide association study of total bilirubin and cholelithiasis risk in sickle cell anemia., PLoS ONE , 7(4), e34741, 2012
Created on 2016-05-18 14:29:31, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.