IthaID: 2854
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs10168155 | HGVS Name: | NG_002601.2:g.103447C>T |
Context nucleotide sequence:
TCATGGAAATGGAAGCCTTTATGAC [C/T] GGCTTCTTTCACTTAGTTTTGTGGC (Strand: +)
Also known as:
Comments: SNP associated with risk of cholelithiasis and variation in bilirubin levels in the Cooperative Study of Sickle Cell Disease (CSSCD; n=1117). The association with bilirubin levels was replicated in three independent studies, namely the Pulmonary Hypertension and Sickle Cell Disease with Sildenafil Therapy (Walk-PHaSST; n=522), the Outcome Modifying Genes study (n=530), and the SITT silent cerebral infarct trial (n=905). This SNP overlaps the UGT1A7, UGT1A8, UGT1A9 and UGT1A10 genes within the UGT1A locus.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Gallstones [HP:0001081] [OMIM:600803] Bilirubin levels |
Location
| Chromosome: | 2 |
|---|---|
| Locus: | NG_002601.2 |
| Locus Location: | 103447 |
| Size: | 1 bp |
| Located at: | UGT1A10 |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Milton JN, Sebastiani P, Solovieff N, Hartley SW, Bhatnagar P, Arking DE, Dworkis DA, Casella JF, Barron-Casella E, Bean CJ, Hooper WC, DeBaun MR, Garrett ME, Soldano K, Telen MJ, Ashley-Koch A, Gladwin MT, Baldwin CT, Steinberg MH, Klings ES, A genome-wide association study of total bilirubin and cholelithiasis risk in sickle cell anemia., PLoS ONE , 7(4), e34741, 2012