IthaID: 2837

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TGAAGAAGACAGGCAGAATGAGAAA [A/C] AAAGACGAACAATGTTGGCCAACCC (Strand: +)

Comments: SNP associated with HbF levels in healthy Northern Europeans (TwinUK cohort; n=2041), as well as in the general (non-anaemic) population of Sardinia. It associated with disease severity and HbF levels in Thai and Indonesian β0-thalassaemia/HbE patients.

Heterozygous records (preview in IthaPhen)

1. Thein SL, Menzel S, Peng X, Best S, Jiang J, Close J, Silver N, Gerovasilli A, Ping C, Yamaguchi M, Wahlberg K, Ulug P, Spector TD, Garner C, Matsuda F, Farrall M, Lathrop M, Intergenic variants of HBS1L-MYB are responsible for a major quantitative trait locus on chromosome 6q23 influencing fetal hemoglobin levels in adults., Proc. Natl. Acad. Sci. U.S.A. , 104(27), 11346-51, 2007
2. Uda M, Galanello R, Sanna S, Lettre G, Sankaran VG, Chen W, Usala G, Busonero F, Maschio A, Albai G, Piras MG, Sestu N, Lai S, Dei M, Mulas A, Crisponi L, Naitza S, Asunis I, Deiana M, Nagaraja R, Perseu L, Satta S, Cipollina MD, Sollaino C, Moi P, Hirschhorn JN, Orkin SH, Abecasis GR, Schlessinger D, Cao A, Genome-wide association study shows BCL11A associated with persistent fetal hemoglobin and amelioration of the phenotype of beta-thalassemia., Proc. Natl. Acad. Sci. U.S.A. , 105(5), 1620-5, 2008
3. Nuinoon M, Makarasara W, Mushiroda T, Setianingsih I, Wahidiyat PA, Sripichai O, Kumasaka N, Takahashi A, Svasti S, Munkongdee T, Mahasirimongkol S, Peerapittayamongkol C, Viprakasit V, Kamatani N, Winichagoon P, Kubo M, Nakamura Y, Fucharoen S, A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E., Hum. Genet. , 127(3), 303-14, 2010