IthaID: 2826
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs2855122 | HGVS Name: | NG_000007.3:g.41610G>A |
Context nucleotide sequence:
AAGCCAGATTTCCAGAGTTTCTGAC [A/G] TCATAATCTACCAAGGTCATGGATC (Strand: -)
Also known as:
Comments: SNP associated with elevated HbF in African Americans with sickle cell disease, recruited from the Cooperative Study of Sickle Cell Disease (CSSCD), the Comprehensive Sickle Cell Centers Collaborative Data (CDATA) study and the Thomas Jefferson University (n=244). SNP associated with HbF levels in individuals from the SardiNIA study. SNP associated with disease severity and HbF levels in Thai β0-thalassaemia/HbE patients. SNP is located in the cAMP response element (TGACGTCA) upstream of Gγ-globin (G-CRE). The trans-acting factor CREB1 binds the G-CRE to induce γ-globin expression.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 41610 |
| Size: | 1 bp |
| Located at: | Gγ |
| Specific Location: | Intron |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American, Thai, Sardinian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Nuinoon M, Makarasara W, Mushiroda T, Setianingsih I, Wahidiyat PA, Sripichai O, Kumasaka N, Takahashi A, Svasti S, Munkongdee T, Mahasirimongkol S, Peerapittayamongkol C, Viprakasit V, Kamatani N, Winichagoon P, Kubo M, Nakamura Y, Fucharoen S, A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E., Hum. Genet. , 127(3), 303-14, 2010
- Danjou F, Zoledziewska M, Sidore C, Steri M, Busonero F, Maschio A, Mulas A, Perseu L, Barella S, Porcu E, Pistis G, Pitzalis M, Pala M, Menzel S, Metrustry S, Spector TD, Leoni L, Angius A, Uda M, Moi P, Thein SL, Galanello R, Abecasis GR, Schlessinger D, Sanna S, Cucca F, Genome-wide association analyses based on whole-genome sequencing in Sardinia provide insights into regulation of hemoglobin levels., Nat. Genet. , 47(11), 1264-71, 2015
- Liu L, Pertsemlidis A, Ding LH, Story MD, Steinberg MH, Sebastiani P, Hoppe C, Ballas SK, Pace BS, A case-control genome-wide association study identifies genetic modifiers of fetal hemoglobin in sickle cell disease., Exp. Biol. Med. (Maywood) , 2016