IthaID: 2821
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs10195871 | HGVS Name: | NG_011968.1:g.65045T>C |
Context nucleotide sequence:
CCTGGAGAGTTCAACTCCAAACCCT [A/G] TATCCCAGCTATCTGTTTGGCTCAG (Strand: +)
Also known as:
Comments: SNP associated with elevated HbF in African Americans with sickle cell disease (SCD), recruited from the Cooperative Study of Sickle Cell Disease (CSSCD), the Comprehensive Sickle Cell Centers Collaborative Data (CDATA) study, and the Thomas Jefferson University. The association was replicated in an independent patient sample acquired from the CSSCD study. Also, the G allele associated with HbF in Kuwaiti patients with SCD. The SNP was found in strong LD (X2 = 0.9) with rs10172646 and in moderate LD (X2 = 0.6) with rs11886868. [PMID: 34204365].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 2 |
|---|---|
| Locus: | NG_011968.1 |
| Locus Location: | 65045 |
| Size: | 1 bp |
| Located at: | BCL11A |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American, Kuwaiti |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Liu L, Pertsemlidis A, Ding LH, Story MD, Steinberg MH, Sebastiani P, Hoppe C, Ballas SK, Pace BS, A case-control genome-wide association study identifies genetic modifiers of fetal hemoglobin in sickle cell disease., Exp. Biol. Med. (Maywood) , 2016
- Akbulut-Jeradi N, Fernandez MJ, Al Khaldi R, Sukumaran J, Adekile A, Unique Polymorphisms at , and Loci Associated with HbF in Kuwaiti Patients with Sickle Cell Disease., J Pers Med, 11(6), , 2021