IthaID: 2816
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs10837631 | HGVS Name: | NG_000007.3:g.72490A>T |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TTATCCTGCATCTCTCAGCCTTG [A>T] CTCCACTCAGTTCTCTTGCTTAG (Strand: -)
Comments: Variant associated with HbF levels in patients from Thailand with HbE/β0-thalassemia, who were classified as clinically mild for the disease (n=207). It also identifies the RFLP site HinfI in the beta-globin gene cluster for the characterization of βS haplotypes (Benin, Bantu, Senegal, Cameroon, Arab-Indian).
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72490 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Thai |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Ma Q, Abel K, Sripichai O, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Fucharoen S, Braun A, Farrer LA, Beta-globin gene cluster polymorphisms are strongly associated with severity of HbE/beta(0)-thalassemia., Clin. Genet. , 72(6), 497-505, 2007
- Shaikho EM, Farrell JJ, Alsultan A, Qutub H, Al-Ali AK, Figueiredo MS, Chui DHK, Farrer LA, Murphy GJ, Mostoslavsky G, Sebastiani P, Steinberg MH, A phased SNP-based classification of sickle cell anemia HBB haplotypes., BMC Genomics, 18(1), 608, 2017
Created on 2016-05-17 10:57:04,
Last reviewed on 2020-04-22 14:09:58 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.