IthaID: 2815


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2071348 HGVS Name: NG_000007.3:g.54700A>C

Context nucleotide sequence:
AAAATTTGGTAGAGCAAGGACTATG [A/C] ATAATGGAAGGCCACTTACCATTTG (Strand: -)

Also known as:

Comments: Associated with disease severity and HbF levels in Thai and Indonesian β0-thalassaemia/HbE patients. Associated with higher Hb F levels and a milder β-thal disease phenotype in β-thal patients (major and/or intermedia) of Greek origin.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
Severity [HP:0012824]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 54700
Size: 1 bp
Located at: pseudo β
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Thai, Indonesian, Greek
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Ma Q, Abel K, Sripichai O, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Fucharoen S, Braun A, Farrer LA, Beta-globin gene cluster polymorphisms are strongly associated with severity of HbE/beta(0)-thalassemia., Clin. Genet. , 72(6), 497-505, 2007
  2. Nuinoon M, Makarasara W, Mushiroda T, Setianingsih I, Wahidiyat PA, Sripichai O, Kumasaka N, Takahashi A, Svasti S, Munkongdee T, Mahasirimongkol S, Peerapittayamongkol C, Viprakasit V, Kamatani N, Winichagoon P, Kubo M, Nakamura Y, Fucharoen S, A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E., Hum. Genet. , 127(3), 303-14, 2010
  3. Sherva R, Sripichai O, Abel K, Ma Q, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Svasti S, Fucharoen S, Braun A, Farrer LA, Genetic modifiers of Hb E/beta0 thalassemia identified by a two-stage genome-wide association study., BMC Med. Genet. , 11(0), 51, 2010
  4. Giannopoulou E, Bartsakoulia M, Tafrali C, Kourakli A, Poulas K, Stavrou EF, Papachatzopoulou A, Georgitsi M, Patrinos GP, A single nucleotide polymorphism in the HBBP1 gene in the human β-globin locus is associated with a mild β-thalassemia disease phenotype., Hemoglobin , 36(5), 433-45, 2012
Created on 2016-05-17 10:53:22, Last reviewed on 2021-07-08 15:56:33 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.