IthaID: 281
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | IVS I [3 end] -44 bp | HGVS Name: | HBB:c.76_92+27del |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CAAGGTGAACGTGGATGAAGTTGGT [-/GGTGAGGC] TAAGGAGACCAATAGAAACTGGGCA (Strand: -)
Also known as: 44 bp deletion
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70670 |
| Size: | 44 bp |
| Deletion involves: | β |
Other details
| Type of Mutation: | Deletion |
|---|---|
| Ethnic Origin: | Greek, Macedonian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Breakpoint Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Gonzalez-Redondo JM, Kattamis C, Huisman TH, Characterization of three types of beta zero-thalassemia resulting from a partial deletion of the beta-globin gene., Hemoglobin, 13(4), 377-92, 1989
Created on 2010-06-16 16:13:15,
Last reviewed on 2013-10-15 17:28:32 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.