IthaID: 2807


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs10837643 HGVS Name: NG_000007.3:g.60808A>T

Context nucleotide sequence:
TAAGGCCATGAGGACTGTTATTTGA [A/T] CTTTGTCTGTTAATTCCAAAGACTT (Strand: +)

Also known as:

Comments: SNP associated with HbF levels in patients from Thailand with HbE/β0-thalassemia, who were classified as clinically mild for the disease (n=207).

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 60808
Size: 1 bp
Located at: HBD-HBBP1
Specific Location: N/A

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Thai
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Publications / Origin

  1. Sherva R, Sripichai O, Abel K, Ma Q, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Svasti S, Fucharoen S, Braun A, Farrer LA, Genetic modifiers of Hb E/beta0 thalassemia identified by a two-stage genome-wide association study., BMC Med. Genet. , 11(0), 51, 2010
Created on 2016-05-17 09:30:41, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.