IthaID: 2804


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2070972 HGVS Name: NG_000007.3:g.44129T>G

Context nucleotide sequence:
ATAGGCTTGATTCTGGGTGGAAGCT [T/G] GGTGTGTAGTTATCTGGAGGCCAGG (Strand: -)

Also known as:

Comments: Variant associated with HbF levels and disease severity in patients from Thailand with HbE/β0-thalassemia. It also identifies the RFLP site HindIII in the beta-globin gene cluster for the characterization of βS haplotypes (Benin, Bantu, Senegal, Cameroon, Arab-Indian).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
Severity [HP:0012824]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 44129
Size: 1 bp
Located at:
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Thai
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Sherva R, Sripichai O, Abel K, Ma Q, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Svasti S, Fucharoen S, Braun A, Farrer LA, Genetic modifiers of Hb E/beta0 thalassemia identified by a two-stage genome-wide association study., BMC Med. Genet. , 11(0), 51, 2010
  2. Shaikho EM, Farrell JJ, Alsultan A, Qutub H, Al-Ali AK, Figueiredo MS, Chui DHK, Farrer LA, Murphy GJ, Mostoslavsky G, Sebastiani P, Steinberg MH, A phased SNP-based classification of sickle cell anemia HBB haplotypes., BMC Genomics, 18(1), 608, 2017
Created on 2016-05-16 18:43:24, Last reviewed on 2021-07-09 14:20:40 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.