IthaID: 280


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS I [3' end] (-25 bp) HGVS Name: HBB:c.93-21_96del
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CACTGACTCTCTCTGCCTAT [TGGTCTATTTTCCCACCCTTAGGCT/-] GCTGGTGGTCTACCCTTGGA (Strand: -)

Also known as: 25 bp deletion

Comments: An updated case was reported in a 20-year-old female with severe microcytosis and hypochromia and increased Hb A2 level.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70795
Size: 25 bp
Located at: β
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Middle East
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Orkin SH, Sexton JP, Goff SC, Kazazian HH, Inactivation of an acceptor RNA splice site by a short deletion in beta-thalassemia., The Journal of biological chemistry, 258(12), 7249-51, 1983

Microattributions

A/AContributor(s)DateComments
1Feleki, Xenia2022-09-23Report of an update.
Created on 2010-06-16 16:13:15, Last reviewed on 2022-09-23 10:46:49 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.