IthaID: 280
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | IVS I [3' end] (-25 bp) | HGVS Name: | NC_000011.10(NM_000518.4):c.93-22_95del |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CACTGACTCTCTCTGCCTAT [TGGTCTATTTTCCCACCCTTAGGCT/-] GCTGGTGGTCTACCCTTGGA (Strand: -)
Also known as: 25 bp deletion
Comments: The original publication regarding this 25 bp deletion [PMID: 6190800] describes two possible deletion ranges due to the presence of a T at both the 5' and 3' boundaries. In accordance with the HGVS 3' rule, this variant can be designated as NC_000011.10:g.5226798_5226822del and for the affected transcript as NC_000011.10(NM_000518.4):c.93-22_95del. An updated case was reported in a 20-year-old female with severe microcytosis and hypochromia and increased Hb A2 level.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70795 |
| Size: | 25 bp |
| Located at: | β |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Middle East |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Orkin SH, Sexton JP, Goff SC, Kazazian HH, Inactivation of an acceptor RNA splice site by a short deletion in beta-thalassemia., The Journal of biological chemistry, 258(12), 7249-51, 1983
- Hassan SM, Vossen RH, Chessa R, den Dunnen JT, Bakker E, Giordano PC, Harteveld CL, Molecular diagnostics of the HBB gene in an Omani cohort using bench-top DNA Ion Torrent PGM technology., Blood Cells Mol Dis, 53(3), 133-7, 2014
- Adekile AD, Azab AF, Al-Sharida SI, Al-Nafisi BA, Akbulut N, Marouf RA, Mustafa NY, Clinical and Molecular Characteristics of Non-Transfusion-Dependent Thalassemia in Kuwait., Hemoglobin , 39(5), 320-6, 2015
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Feleki, Xenia | 2022-09-23 | Report of an update. |