IthaID: 2790



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs7482144 HGVS Name: NG_000007.3:g.42677C>T

Context nucleotide sequence:
AACCCATGGGTGGAGTTTAGCCAGG [A/C/G/T] ACCGTTTCAGACAGATATTTGCATT (Strand: +)

Comments: This SNP is found 158 bp upstream of the HBG2 gene promoter, affecting the expression of this gene only. SNP associated with F-cell variation in healthy Northern Europeans (TwinsUK cohort; n=269 and n=775 in two independent studies). It associated with HbF levels in the Cooperative Study of Sickle Cell Disease (CSSCD; n=1518 and n=1275 in two independent studies) and a Brazilian sickle cell disease (SCD) study sample (n=167). It associated with HbF levels and F-cell numbers in a Hong Kong Chinese sample heterozygous for the β-thalassemia mutation (n=241). It associated with HbF levels in a study sample of Thai patients with HbE/β0-thalassemia, who were classified as clinically mild (n=207) or severe (n=305) for the disease. It associated with HbF levels in Portuguese β-thal carriers. It had a modifying effect on HbF and clinical score in Indonesian HbE/β-thal patients. The XmnI T allele associated with elevated HbF in Thai individuals with homozygous HbE (n=115), as well as with high Gγ expression in patients with SCD (Georgia, Turkey, Surinam and Saudi Arabia) and β-thalassemia (Georgia, Algeria and Sicily). The association was not replicated in a Cameroonian SCD cohort (n=596).

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 42677
Size: 1 bp
Located at:
Specific Location: N/A

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
F-cell numbers

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Northern European, African American, Brazilian, Chinese, African, Sicilian, Algerian, Thai, Indonesian, Portuguese
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Gilman JG, Huisman TH, DNA sequence variation associated with elevated fetal G gamma globin production., Blood , 66(4), 783-7, 1985 PubMed
  2. Labie D, Dunda-Belkhodja O, Rouabhi F, Pagnier J, Ragusa A, Nagel RL, The -158 site 5' to the G gamma gene and G gamma expression., Blood , 66(6), 1463-5, 1985 PubMed
  3. Garner C, Tatu T, Reittie JE, Littlewood T, Darley J, Cervino S, Farrall M, Kelly P, Spector TD, Thein SL, Genetic influences on F cells and other hematologic variables: a twin heritability study., Blood , 95(1), 342-6, 2000 PubMed
  4. Menzel S, Garner C, Gut I, Matsuda F, Yamaguchi M, Heath S, Foglio M, Zelenika D, Boland A, Rooks H, Best S, Spector TD, Farrall M, Lathrop M, Thein SL, A QTL influencing F cell production maps to a gene encoding a zinc-finger protein on chromosome 2p15., Nat. Genet. , 39(10), 1197-9, 2007 PubMed
  5. Ma Q, Abel K, Sripichai O, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Fucharoen S, Braun A, Farrer LA, Beta-globin gene cluster polymorphisms are strongly associated with severity of HbE/beta(0)-thalassemia., Clin. Genet. , 72(6), 497-505, 2007 PubMed
  6. Lettre G, Sankaran VG, Bezerra MA, Araújo AS, Uda M, Sanna S, Cao A, Schlessinger D, Costa FF, Hirschhorn JN, Orkin SH, DNA polymorphisms at the BCL11A, HBS1L-MYB, and beta-globin loci associate with fetal hemoglobin levels and pain crises in sickle cell disease., Proc. Natl. Acad. Sci. U.S.A. , 105(33), 11869-74, 2008 PubMed
  7. Sebastiani P, Wang L, Nolan VG, Melista E, Ma Q, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: Bayesian modeling of genetic associations., Am. J. Hematol. , 83(3), 189-95, 2008 PubMed
  8. Gibney GT, Panhuysen CI, So JC, Ma ES, Ha SY, Li CK, Lee AC, Li CK, Yuen HL, Lau YL, Johnson DM, Farrell JJ, Bisbee AB, Farrer LA, Steinberg MH, Chan LC, Chui DH, Variation and heritability of Hb F and F-cells among beta-thalassemia heterozygotes in Hong Kong., Am. J. Hematol. , 83(6), 458-64, 2008 PubMed
  9. Nuinoon M, Makarasara W, Mushiroda T, Setianingsih I, Wahidiyat PA, Sripichai O, Kumasaka N, Takahashi A, Svasti S, Munkongdee T, Mahasirimongkol S, Peerapittayamongkol C, Viprakasit V, Kamatani N, Winichagoon P, Kubo M, Nakamura Y, Fucharoen S, A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E., Hum. Genet. , 127(3), 303-14, 2010 PubMed
  10. He Y, Lin W, Luo J, Influences of genetic variation on fetal hemoglobin., Pediatr Hematol Oncol , 28(8), 708-17, 2011 PubMed
  11. Green NS, Ender KL, Pashankar F, Driscoll C, Giardina PJ, Mullen CA, Clark LN, Manwani D, Crotty J, Kisselev S, Neville KA, Hoppe C, Barral S, Candidate sequence variants and fetal hemoglobin in children with sickle cell disease treated with hydroxyurea., PLoS ONE , 8(2), e55709, 2013 PubMed
  12. Cardoso GL, Diniz IG, Silva AN, Cunha DA, Silva Junior JS, Uchôa CT, Santos SE, Trindade SM, Cardoso Mdo S, Guerreiro JF, DNA polymorphisms at BCL11A, HBS1L-MYB and Xmn1-HBG2 site loci associated with fetal hemoglobin levels in sickle cell anemia patients from Northern Brazil., Blood Cells Mol. Dis. , 53(4), 176-9, 2014 PubMed
  13. Wonkam A, Ngo Bitoungui VJ, Vorster AA, Ramesar R, Cooper RS, Tayo B, Lettre G, Ngogang J, Association of variants at BCL11A and HBS1L-MYB with hemoglobin F and hospitalization rates among sickle cell patients in Cameroon., PLoS ONE , 9(3), e92506, 2014 PubMed
  14. Pakdee N, Yamsri S, Fucharoen G, Sanchaisuriya K, Pissard S, Fucharoen S, Variability of hemoglobin F expression in hemoglobin EE disease: hematological and molecular analysis., Blood Cells Mol. Dis. , 53(1), 11-5, 2014 PubMed
  15. Pereira C, Relvas L, Bento C, Abade A, Ribeiro ML, Manco L, Polymorphic variations influencing fetal hemoglobin levels: association study in beta-thalassemia carriers and in normal individuals of Portuguese origin., Blood Cells Mol. Dis. , 54(4), 315-20, 2015 PubMed
  16. Vathipadiekal V, Alsultan A, Baltrusaitis K, Farrell JJ, Al-Rubaish AM, Al-Muhanna F, Naserullah Z, Suliman A, Patra PK, Milton JN, Farrer LA, Chui DH, Al-Ali AK, Sebastiani P, Steinberg MH, Homozygosity for a haplotype in the HBG2-OR51B4 region is exclusive to Arab-Indian haplotype sickle cell anemia., Am. J. Hematol. , 91(6), E308-11, 2016 PubMed
  17. Rujito L, Basalamah M, Siswandari W, Setyono J, Wulandari G, Mulatsih S, Sofro AS, Sadewa AH, Sutaryo S, Modifying effect of XmnI, BCL11A, and HBS1L-MYB on clinical appearances: A study on β-thalassemia and hemoglobin E/β-thalassemia patients in Indonesia., Hematol Oncol Stem Cell Ther , 9(2), 55-63, 2016 PubMed
Created on 2016-05-16 17:02:38, Last reviewed on 2019-03-27 13:56:27 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.