IthaID: 2788

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs12160039 HGVS Name: NG_023030.1:g.18226T>A, NG_023030.1:g.18226T>C

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TTTCTTGCGTGCTCGGTAGGAGAAG [A/C/T] GGTGATAGGGGGTTGGCAGGAGCTG (Strand: +)

Comments: SNP associated with acute chest syndrome in the Cooperative Study of Sickle Cell Disease (CSSCD) (1514 subjects).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Acute chest syndrome

Location

Chromosome: 22
Locus: NG_023030.1
Locus Location: 18226
Size: 1 bp
Located at: HMOX1
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Galarneau G, Coady S, Garrett ME, Jeffries N, Puggal M, Paltoo D, Soldano K, Guasch A, Ashley-Koch AE, Telen MJ, Kutlar A, Lettre G, Papanicolaou GJ, Gene-centric association study of acute chest syndrome and painful crisis in sickle cell disease patients., Blood , 122(3), 434-42, 2013
Created on 2016-05-16 16:02:21, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.