IthaID: 2786
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs4803221 | HGVS Name: | NG_042193.1:g.1483G>C |
Context nucleotide sequence:
TCCGGGGCTCCAGCGAGCGGTAGTG [C/G] GAGAGCAGGCAGCGCCGGGGGGCCG (Strand: +)
Also known as:
Comments: SNP associated with viral clearance prediction in β-thalassaemia patients recruited from two Italian major centers in Cagliari and Torino (368 cases; 215 controls).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Response to Hepatitis C treatment |
Location
| Chromosome: | 19 |
|---|---|
| Locus: | NG_042193.1 |
| Locus Location: | 1483 |
| Size: | 1 bp |
| Located at: | IFNL3 |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Italian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Origa R, Marceddu G, Danjou F, Perseu L, Satta S, Demartis FR, Piga A, Longo F, Lai ME, Vacquer S, Galanello R, IFNL3 polymorphisms and HCV infection in patients with beta thalassemia., Ann Hepatol , 14(3), 389-95, 2015
Created on 2016-05-16 15:11:15,
Last reviewed on 2019-07-03 22:18:09 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.