IthaID: 2785


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs12979860 HGVS Name: NG_042193.1:g.1825G>A

Context nucleotide sequence:
TGAACCAGGGAGCTCCCCGAAGGCG [C/T] GAACCAGGGTTGAATTGCACTCCGC (Strand: +)

Also known as:

Comments: SNP is located 3 kb upstream of the IL28B (IFNL3) gene. The C allele has been associated with response to antiviral therapy and spontaneous clearance of Hepatitis C in patients with β-thalassaemia from Italy, Iran and India.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Response to Hepatitis C treatment

Location

Chromosome: 19
Locus: NG_042193.1
Locus Location: 1825
Size: 1 bp
Located at: IFNL3
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Italian, Iranian, Indian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Origa R, Marceddu G, Danjou F, Perseu L, Satta S, Demartis FR, Piga A, Longo F, Lai ME, Vacquer S, Galanello R, IFNL3 polymorphisms and HCV infection in patients with beta thalassemia., Ann Hepatol , 14(3), 389-95, 2015
  2. Behnava B, Sharafi H, Keshvari M, Pouryasin A, Mehrnoush L, Salimi S, Karimi Elizee P, Ghazimoghaddam M, Alavian SM, The Role of Polymorphisms Near the IL28B Gene on Response to Peg-Interferon and Ribavirin in Thalassemic Patients With Hepatitis C., Hepat Mon , 16(1), e32703, 2016
  3. Biswas A, Firdaus R, Gupta D, Ghosh M, Saha K, Chowdhury P, Bhattacharyya M, Sadhukhan PC, Interferon λ3 gene (IL28B) is associated with spontaneous or treatment-induced viral clearance in hepatitis C virus-infected multitransfused patients with thalassemia., Transfusion , 57(6), 1376-1384, 2017
Created on 2016-05-16 15:08:03, Last reviewed on 2019-07-03 22:19:06 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.