
IthaID: 2784
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs55659002 | HGVS Name: | NG_013364.1:g.16889delC |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGCGGCCGGTAGTGAACCCTGCTTT [-/G] GTGTGGGAGTCAGGGGATAGGGGAC (Strand: +)
Comments: SNP associated with low bone mineral density in patients with β-thalassemia major acquired from the SGPGIMS medical institute in India (n=150) [PMID: 23790953]. The association was not replicated in an independent study, which recruited patients with β-thalassemia major from Italy (n=135) [PMID: 11122085].
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Osteoporosis [HP:0000939] [OMIM:166710] |
Location
Chromosome: | 19 |
---|---|
Locus: | NG_013364.1 |
Locus Location: | 16889 |
Size: | 1 bp |
Located at: | TGFB1 |
Specific Location: | Intron 4 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | North Indian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Perrotta S, Cappellini MD, Bertoldo F, Servedio V, Iolascon G, D'Agruma L, Gasparini P, Siciliani MC, Iolascon A, Osteoporosis in beta-thalassaemia major patients: analysis of the genetic background., Br. J. Haematol. , 111(2), 461-6, 2000
- Singh K, Agarwal S, Shukla A, Gupta S, A sequence variation: 713-8delC in the transforming growth factor beta 1 gene polymorphism in thalassemia major patients., J Clin Densitom , 17(1), 185-9, 2014
Created on 2016-05-16 15:01:34,
Last reviewed on 2016-05-16 15:04:15 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.