IthaID: 2782
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs7203560 | HGVS Name: | NG_029669.1:g.9308A>C |
Context nucleotide sequence:
AAATTTAAAAACCTAGTGATGAATC [G/T] AAGAAGAGTGCAAAAGGCCCATGAA (Strand: +)
Also known as:
Comments: SNP associated with haemolytic anaemia in the Cooperative Study of Sickle Cell Disease (CSSCD; n=1117), the Pulmonary Hypertension and Sickle Cell Disease with Sildenafil Therapy (Walk-PHaSST) study (n=449), as well as in a cohort of SCA patients from London, UK (n=213). The haemolytic score was derived from reticulocyte count, serum bilirubin, lactate dehydrogenase (LDH), and aspartate transaminase (AST) levels. SNP significantly associated with a lower level of each of the four haemolytic markers in the CSSCD study.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Bilirubin levels Reticulocytopenia [HP:0001896] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_029669.1 |
| Locus Location: | 9308 |
| Size: | 1 bp |
| Located at: | NPRL3 |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Milton JN, Rooks H, Drasar E, McCabe EL, Baldwin CT, Melista E, Gordeuk VR, Nouraie M, Kato GR, Kato GJ, Minniti C, Taylor J, Campbell A, Luchtman-Jones L, Rana S, Castro O, Zhang Y, Thein SL, Sebastiani P, Gladwin MT, , Steinberg MH, Genetic determinants of haemolysis in sickle cell anaemia., Br. J. Haematol. , 161(2), 270-8, 2013